DNA Protein Synthesis

DNA Protein Synthesis preview image

1 collaborator

Uri_dolphin3 Uri Wilensky (Author)

Tags

ccl 

Tagged by Uri Wilensky about 13 years ago

Model group CCL | Visible to everyone | Changeable by group members (CCL)
Model was written in NetLogo 5.0.4 • Viewed 977 times • Downloaded 122 times • Run 0 times
Download the 'DNA Protein Synthesis' modelDownload this modelEmbed this model

Do you have questions or comments about this model? Ask them here! (You'll first need to log in.)


WHAT IS IT?

This model allows you to explore the effects of deletion, substitution, and insertion mutations on a single strand of DNA and the subsequent outcomes in related protein synthesis in cells. The model represents effects from mutations that include 1) the number of genes that are encoded in the DNA, 2) the mRNA molecules that are transcribed, and 3) the tRNA molecules that are used to transcribe the mRNA into an amino acid chain, as wells as 4) the subsequent protein that is synthesized.

HOW IT WORKS

In this model nucleotides are molecules, that when joined together, make up the structural units of DNA. Visually this appears as single nitrogen base (represented as a colored polygon) and 1 phosphate group (represented as a yellow circle). Only a single strand of the double stranded DNA molecule is show in this model, as the protein synthesis process starts with the doubled stranded DNA being unwound into two single strands to permit mRNA production.

The nitrogen bases for DNA come in four variations: ([A]denine, [G]uanine, [T]hymine, [C]ytosine) bound to a ribose or deoxyribose backbone.

The same nitrogen bases are used for mRNA and tRNA, as for DNA, except no [T]hymine is used. Instead it is replaced with [U]racil.

Genes start locations in DNA are encoded by a three letter sequence of nucleotides [ATG], when read from a particular direction. In this model, reading occurs from left to right. Gene stop locations are encoded either by the first three letter sequence (either [] or [] or []) that is encountered, which is the same reading frame as the ATG sequence at the start of the gene. Reading frames may be shifted by 0, 1, or 2 nucleotides from the start of the gene. Stop signals have three possible three nucleotides sequences ([TAG], [TGA], or [TAA])

If the first letter of the three letter sequence for stop has any multiple of 3 nucleotides between it and the last letter of the ATG marking the start, then it is in the same frame of reference and will apply as a stop signal for this gene. If not, the stop signal is ignored. If no stop signal is found in the DNA, the gene end will continue until end of the entire DNA strand (the far right side of the DNA in this model).

In order for DNA to produce proteins for each gene, the following four steps must be followed by the user, after GO/STOP is pressed to start running the model.

  1. For each gene an mRNA molecule must be transcribed. This is done by pressing the 1-TRANSCRIBE for genes in the original strand of DNA or 6-TRANSCRIBE for the genes in the duplicated strand of dan. Each time this button is pressed, the next gene in the strand of DNA will be transcribed. When the last gene is reached, then the next gene chosen to transcribe will be the first gene (reading from left to right).

  2. For each mRNA molecule that was transcribed in the original DNA, the 2-RELEASE button must be pressed. For each mRNA molecule that was transcribed in the duplicated DNA, the 7-RELEASE button must be pressed. This simulates the release of the mRNA from the nucleus into the ribosome of the cell.

  3. Once the mRNA has finished moving in to the ribosome, the 3-TRANSLATE button must be pressed to translate the mRNA in the original cell and the 8-TRANSLATE button must be pressed to translate the mRNA in the replicated cell. This pairs a tRNA molecule with each set of three nucleotides in the mRNA molecule.

  4. Once the entire mRNA molecule has been paired with tRNA, the 4-RELEASE button must be pressed to release the amino acid chain from that attached to the tRNA chain in the original cell. And the 9-RELEASE button must be pressed to release it in the replicated cell. This amino-acid chain is the protein molecule before it folds up to take on its tertiary structure.

HOW TO USE IT

NEXT-INSTRUCTION button moves the text in the instruction window forward one "page".

PREVIOUS-INSTRUCTION button moves the text in the instruction window back one "page".

INSTRUCTION # reports the "page" of text in the instruction window being displayed. These are each of the pages of instructions that the user can page through as they run the model:

Instruction 1: You will be simulating the process of protein synthesis from DNA that occurs in every cell and the effects of mutations on the proteins that are produced.

Instruction 2: When you press SETUP, a single strand of an unwound DNA molecule appears. This represents the state of DNA in the cell nucleus during transcription.

Instruction 3: To produce proteins, each gene in the original DNA strand must be transcribed into an mRNA molecule. Do this by pressing the 1-TRANSCRIBE button.

Instruction 4: For each mRNA molecule that was transcribed, press the 2-RELEASE button. This releases the mRNA from the nucleus into the ribosome of the cell.

Instruction 5: For each mRNA molecule in the ribosome, press the 3-TRANSLATE button. This pairs up tRNA molecules with each set of three nucleotides in the mRNA molecule.

Instruction 6: For each tRNA chain built, press the 4-RELEASE button. This releases the amino acid chain from the rest of the tRNA chain, leaving behind the protein molecule that is produced.

Instruction 7: Each time the 1-TRANSCRIBE button is pressed, the next gene in the original strand of DNA will be transcribed. Press the 1-, 2-, 3-, 4-, buttons and repeat to translate each subsequent gene into a protein.

Instruction 8: When you press the 5-REPLICATE THE ORIGINAL DNA button a copy of the original DNA will be generated for a new cell (as in mitosis or meiosis) and appear in the green.

Instruction 9: The replicated DNA will have a number of random mutations, set by #-NUCLEOTIDES-AFFECTED, each mutation of the type set by MUTATION-TYPE. Press button 5-REPLICATE THE ORIGINAL DNA again to explore possible outcomes.

Instruction 10: Now repeat the same transcription, release, translation, and release process for the DNA in this new cell. To do that, press 6-, 7-, 8-, 9- buttons. Again repeat that sequence to cycle through each gene in this mutated DNA.

Instruction 11: If you want to test the outcomes for your own DNA code, type any sequence of A, G, T, C in the USER-CREATED-CODE box and set the INITIAL-DNA-STRING to “from-user-code”. The default is set to "AAAAA", but any sequence of letters can be processed. Strings longer than 64 letters will be trimmed to the first 64 letters and letters that are not A, G, T, or C, will be randomly replaced by one of these letters.

Other Setting Information:

SHOW-GENES? controls whether the start and end codons for each gene are visibly tagged in the DNA.

INITIAL-DNA-STRING can be set to "from user-created-code" (see above), or to any of the following: "no genes (short strand)", "no genes (long strand)", "1 short gene", "1 long gene", "2 sequential genes", "2 nested genes", "3 sequential genes", "random (short strand)", "random (long strand)". Both random settings are fixed length, but random code in that length of DNA.

Buttons 1-4 affect the original cell's DNA. Button 5 affects the duplicated DNA that ends up in the new cell Buttons 6-9 affect the duplicated cell's DNA

The 10-SHOW PRODUCTION SUMMARY button reports all the proteins that produced in both the original cell and in the duplicated cell.

MUTATION-TYPE can be set to deletion, insertion or substitution. The number of nucleotides affected is set by #-NUCLEOTIDES-AFFECTED. So 6 substitutions will place 6 random nucleotides in place of back to back sequence of 6 original nucleotides at a random location in the DNA. And 4 insertions will add 4 random nucleotides in sequence at a random location in the DNA. And 3 deletions will delete 3 random nucleotides in sequence at a random location in the DNA.

THINGS TO NOTICE

Sometimes the end location for 1 gene is the same as for another gene. This may make it hard to distinguish the numbering of each of the tags for these end locations, since when they are stacked on top of each other at the same location, their text and colors overlap.

Some mutations introduce brand new genes into a strand of DNA. Some mutations remove an entire gene in a strand of DNA. Some only affect a few of the amino acids that used in protein synthesis. Others affect many. And some mutation affect the non-coding regions of DNA, resulting in no effects in the proteins produced by the cell.

THINGS TO TRY

Start with a section of DNA with no genes. How often does a mutation result in the emergence of new gene?

Start with a section of DNA with one or more genes. How often does a mutation result in the disappearance of an old gene?

Are there certain types of mutations (deletion, insertion, or substitution) that seem to affect the structure of the resulting protein more than others?

Why do certain numbers of nucleotides affected (e.g. 3 and 6) seem to affect some aspects of the genes more frequently and not others?

EXTENDING THE MODEL

A representation of protein folding could be added to the model (where each neighboring amino acid affects the amount of relative change in orientation to the previous amino acid).

NETLOGO FEATURES

The model makes use of transparency features in the color channel for the shapes of the start and stop codons in order to allow the user to see the DNA structure beneath them.

The model makes use of "tag" turtles. These breeds of turtles have no visible shape, but do have text labels displayed. They are placed at a fine tuned position near the visible turtle it is helping provide a label for and is linked to it.

RELATED MODELS

DNA Replication Fork is the precursor model to this one. It shows how two types of mutations (deletion and substitution) cam emerge when DNA is duplicated in mitosis or meiosis through simple unintentional copying errors.

CREDITS AND REFERENCES

This model is a part of the BEAGLE curriculum (http://ccl.northwestern.edu/simevolution/beagle.shtml)

HOW TO CITE

If you mention this model in a publication, we ask that you include these citations for the model itself and for the NetLogo software:

COPYRIGHT AND LICENSE

Copyright 2012 Uri Wilensky.

CC BY-NC-SA 3.0

This work is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/3.0/ or send a letter to Creative Commons, 559 Nathan Abbott Way, Stanford, California 94305, USA.

Commercial licenses are also available. To inquire about commercial licenses, please contact Uri Wilensky at uri@northwestern.edu.

Comments and Questions

Click to Run Model

;;;;;;;;;;;;; DNA molecules  ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;  
breed [genes gene]                          ;; keeps a list of the dna code for a given gene
breed [nucleotides nucleotide]              ;; the pieces that are inside the dna chain
breed [promoters promoter]                  ;; a visualization agent (similar to a promoter protein) that attaches to every start codon location in a DNA chain
breed [terminators terminator]              ;; a visualization agent that attaches to every stop codon location in a DNA chain

;;;;;;;;;;;;; mRNA molecules  ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;  
breed [mRNA-nucleotides mRNA-nucleotide]    ;; the pieces that are inside the mRNA chain
breed [mRNAs mRNA]                          ;; the tail ends of the mRNA chain   

;;;;;;;;;;;;; trna molecules  ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;      
breed [tRNAs tRNA]                          ;; the center piece of the tRNA complex
breed [tRNA-nucleotides tRNA-nucleotide]    ;; the pieces that are inside the tRNA complex
breed [amino-acids amino-acid]              ;; the top part of the tRNA complex

;;;;;;;;;;;;; protein molecules  ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;     
breed [proteins protein]                    ;; holds proteins information

;;;;;;;;;;;;; tags for supporting a fine tuned placement of labels ;;;;;;;;;;;;;
breed [tags tag]                 

;;;;;;;;;;;;; links ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
undirected-link-breed [taglines tagline]    ;; the link between an agent and where its label agent is.  This allows fine tuned placement of visualizing of labels
directed-link-breed   [backbones backbone]  ;; the link between adjacent amino acids in a protein.  Tt will allows the entire protein to be folded up (not currently implemented)

;;;;;;;;;;;;;;;;;;;turtle variables ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
genes-own            [gene-number strand code start-position end-position]
mRNAs-own            [gene-number strand code cap-type traveling? released?]
promoters-own        [gene-number strand]
terminators-own      [gene-number strand]
tRNAs-own            [gene-number strand]
proteins-own         [gene-number strand value]
amino-acids-own      [gene-number strand value place]
nucleotides-own      [gene-number strand value place]                                  
mRNA-nucleotides-own [gene-number strand value place] 
tRNA-nucleotides-own [gene-number strand value place] 
tags-own             [value]                               ; the value for the label of the agent it is linked to when visualized.  



;;;;;;;;;;;;;globals ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;

globals [

  current-instruction               ;; holds counter value for which instruction is being displayed
  codon-to-amino-acid-key           ;; holds lookup table for codon triplet to amino acid
  original-dna-string               ;; holds a string of the original DNA
  duplicate-dna-string              ;; holds a string of the duplicate DNA.  This changes every time the replicate DNA button is pressed

  ;; position values for visualization
  duplicate-ribosome-ycor 
  original-ribosome-ycor
  duplicate-dna-ycor 
  original-dna-ycor 
  nucleotide-spacing
  
  ;; colors for various agents and states of agents
  nucleo-tag-color
  terminator-color
  gene-color-counter
  
  ;; counters for the number of genes
  original-strand-gene-counter       
  duplicate-strand-gene-counter
  original-display-mrna-counter
  duplicate-display-mrna-counter
 
  mRNAs-traveling                    ;; list of mRNAs traveling
  mRNAs-released                     ;; list of mRNAs released
   
  ;; for keeping track of user initiated events 
  replicate-dna-event?
  show-genes-event?
  event-1-triggered?
  event-2-triggered?
  event-3-triggered?
  event-4-triggered?
  event-6-triggered?
  event-7-triggered?
  event-8-triggered?
  event-9-triggered?
  event-1-completed?
  event-2-completed?
  event-3-completed?
  event-4-completed?
  event-6-completed?
  event-7-completed?
  event-8-completed?
  event-9-completed?
]

;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;setup procedures;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;

to setup
  clear-all
  set replicate-dna-event? false
  set show-genes-event? false
  
  set event-1-triggered? false
  set event-2-triggered? false
  set event-3-triggered? false
  set event-4-triggered? false
  set event-6-triggered? false
  set event-7-triggered? false
  set event-8-triggered? false
  set event-9-triggered? false
  set event-1-completed? false
  set event-2-completed? false
  set event-3-completed? false
  set event-4-completed? false
  set event-6-completed? false
  set event-7-completed? false
  set event-8-completed? false
  set event-9-completed? false
 
  
  set mRNAs-traveling []                             
  set mRNAs-released  [] 
  set codon-to-amino-acid-key []
  set original-dna-string ""
  set duplicate-dna-string ""
  
  set duplicate-ribosome-ycor -7
  set original-ribosome-ycor 4
  set duplicate-dna-ycor -2
  set original-dna-ycor 1
  set gene-color-counter 1
  set nucleotide-spacing .45 
  
  set original-strand-gene-counter 0
  set duplicate-strand-gene-counter 0
  set original-display-mrna-counter 0
  set duplicate-display-mrna-counter 0
  
  set-default-shape promoters "start"
  set-default-shape terminators "end"
  set-default-shape tags "empty"
  
  set terminator-color      [255 0 0 150]
  set nucleo-tag-color      [255 255 255 120]

  initialize-codon-to-amino-acid-key
  setup-starting-dna
  visualize-all-genes
  ask patches [set pcolor blue - 4]
  ask patches with [pycor > 2]  [set pcolor blue - 3.5]
  ask patches with [pycor < 0]  [set pcolor green - 4]
  ask patches with [pycor < -3] [set pcolor green - 3.5]
  show-instruction 1
  reset-ticks
end 

to setup-starting-dna
  setup-dna-string
  build-genes-from-dna "original" original-dna-string
  make-a-nucleotide-chain-for-dna-string "original" original-dna-string
  place-dna "original"
  build-mrna-for-each-gene "original" 
  build-protein-from-mrna  "original"
  place-trnas "original"
  hide-mrna   "original"
  hide-trna   "original"
  hide-genes  "original"
end 



;; original-dna-string

to setup-dna-string
  if initial-dna-string = "from user-created-code" [set original-dna-string dna-string-with-non-nucleotide-characters-replaced user-created-code]  
  if initial-dna-string = "random (short strand)" [ 
    let initial-length-dna 12
    repeat initial-length-dna [set original-dna-string (word original-dna-string random-base-letter-DNA)]
  ]
  if initial-dna-string = "random (long strand)"  [
    let initial-length-dna 56
    repeat initial-length-dna [set original-dna-string (word original-dna-string random-base-letter-DNA)]
  ]
  if initial-dna-string = "no genes (short strand)" [set original-dna-string "ATTATATCGTAG"] 
  if initial-dna-string = "no genes (long strand)"  [set original-dna-string "GATATTTGGTAGCCCGAGAAGTGGTTTTTCAGATAACAGAGGTGGAGCAGCTTTTAG"]   
  if initial-dna-string = "1 short gene"            [set original-dna-string "ATTATGTGGTAG"]      
  if initial-dna-string = "1 long gene"             [set original-dna-string "GGGATGGACACCTTATCATTTGCTACTAGCGACCAGTTTGAGTAGCTTCGTCGGTGA"]
  if initial-dna-string = "2 sequential genes"      [set original-dna-string "AGTATGAAAACCCACGAGTGGTAGCCCGAGATTGAGATGTGGTTTTTCAGATAACAG"]  
  if initial-dna-string = "2 nested genes"          [set original-dna-string "GTTATGAGGGGGACCCGAGATGTGGTTTTTGAAATAGACAAGTAGACCCTAATAGAC"] 
  if initial-dna-string = "3 sequential genes"      [set original-dna-string "GATATGTGGTAGCCCGAGATGTGGTTTTTCAGATAACAGATGTGGAGCAGCTTTTAG"]   
end 

to place-dna [strand-type]
  let dna (turtle-set genes nucleotides promoters terminators)
  ask dna with [strand = strand-type][
    if strand-type = "original"  [set ycor original-dna-ycor]
    if strand-type = "duplicate" [set ycor duplicate-dna-ycor]
  ]
end 

to place-trnas [strand-type]
  ask trnas with [strand = strand-type] [
    if strand-type = "original"   [set ycor original-ribosome-ycor + 1]
    if strand-type = "duplicate"  [set ycor duplicate-ribosome-ycor + 1]
  ]
end 

to make-a-nucleotide-chain-for-dna-string [strand-type dna-string]
  let previous-nucleotide nobody
  let place-counter 0
  create-turtles 1 [
    set heading 90 
    fd 1 
    repeat (length dna-string) [
        hatch 1 [
          set breed nucleotides 
          set strand strand-type
          set value item place-counter dna-string
          set shape (word "nucleotide-" value) 
          set heading 0          
          set place place-counter
          attach-tag 5 0.5 value nucleo-tag-color
          set place-counter place-counter + 1
          ]
       fd nucleotide-spacing   
       ]
   die ;; remove the chromosome builder (a temporary construction turtle)
  ]
end 

to build-genes-from-dna [strand-type dna-string]
  let remaining-dna dna-string
  let this-item ""
  let last-item ""
  let last-last-item ""
  let triplet ""
  let item-position 0
  let last-item-kept length dna-string
  repeat (length dna-string) [
    let first-item item 0 remaining-dna
    set remaining-dna remove-item 0 remaining-dna
    set last-last-item last-item
    set last-item this-item
    set this-item first-item
    set triplet (word last-last-item last-item this-item)
    if triplet = "ATG" [
      create-genes 1 [
        set hidden? true   
        set strand strand-type
        if strand = "original"  [
          set original-strand-gene-counter original-strand-gene-counter + 1 
          set gene-number original-strand-gene-counter
        ]
        if strand = "duplicate" [
          set duplicate-strand-gene-counter duplicate-strand-gene-counter + 1 
          set gene-number duplicate-strand-gene-counter
        ]
        set start-position item-position
        set end-position ((length original-dna-string))
        set code (word triplet substring dna-string (item-position + 1) ((length dna-string) ) )        
        ]
     ]
     set item-position item-position + 1
  ]     
  ask genes [ 
    let end-of-gene? false
    let triplet-counter 0
    let new-code code
    repeat floor (length code / 3)  [
      let this-triplet (word  (item (0 + (triplet-counter * 3)) code)  (item (1 + (triplet-counter * 3)) code)  (item (2 + (triplet-counter * 3)) code) )
      if (this-triplet =  "TAG" or this-triplet = "TGA"  or this-triplet = "TAA") and not end-of-gene? [
        set end-position triplet-counter * 3 
        set new-code substring code 0 end-position
        set end-of-gene? true
      ]  
      set triplet-counter triplet-counter + 1  
    ]
    set triplet-counter 0
    set end-of-gene? false
    set code new-code
  ]
end 

to build-mRNA-for-each-gene [strand-type] 
  ask genes with [strand = strand-type] [
    let this-code code
    let this-gene self
    
    set heading 90
    fd .1
    repeat start-position [fd .45] ;; move over to correct nucleotide location on dna
   
    let gene-color next-gene-color
    let gene-color-with-transparency (sentence (extract-rgb gene-color) 110)
    let gene-color-label (sentence (extract-rgb gene-color) 250)
    ;; make promoter for start codon
    hatch 1 [
      set breed promoters
      set color gene-color-with-transparency 
      set size 3
      set hidden? false
      attach-tag 142 1.7 (word "start:" gene-number) gene-color-label
      create-backbone-from this-gene [set hidden? true set tie-mode "fixed" tie] 
      ;; make terminator for end codon
      hatch 1 [
        set breed terminators
        fd ((length this-code) * 0.45)
        attach-tag 142 1.7 (word "end:" gene-number) gene-color-label
        create-backbone-from this-gene [set hidden? true set tie-mode "fixed" tie] 
      ]
    ] 
     ;; make start cap for mRNA molecule
    hatch 1 [
      let this-mRNA self
      set breed mRNAs 
      set traveling? false
      set released? false
      set code mrna-string-from-dna-string code
      set cap-type "start"
      set shape "mrna-start"
      set hidden? false
      ;; associate the mRNA molecule with the parent gene
      create-backbone-from this-gene [set hidden? true set tie-mode "fixed" tie]   
      ;; build a stop cap for the mRNA molecule
      hatch 1 [
        set cap-type "stop" 
        set shape "mrna-stop"
        let nucleotide-counter 0 
        ;; associate the mRNA stop cap with the start cap
        create-backbone-from this-mRNA  [set hidden? true set tie-mode "fixed" tie] 
        ;; use the stop cap turtle to construct the mRNA nucleotides
        let code-to-transcribe code
        repeat length code [
          hatch 1 [
            set breed mRNA-nucleotides 
            set value first code-to-transcribe  
            set shape (word "mrna-" value) 
            set heading 180       
            attach-tag 175 0.9 value nucleo-tag-color  
            create-backbone-from this-mRNA  [set hidden? true set tie-mode "fixed" tie] 
          ]
          set code-to-transcribe remove-item 0 code-to-transcribe
          fd nucleotide-spacing           
        ] 
      ]
    ]
  ]   
end 

to build-protein-from-mrna [strand-type]
  ask mrnas with [cap-type = "start" and strand = strand-type] [
    let number-of-triplets-in-list floor ((length code) / 3) 
    let this-triplet ""
    let triplet-counter 0
    repeat number-of-triplets-in-list   [
      set this-triplet (word 
        complementary-mRNA-base  (item (0 + (triplet-counter * 3)) code) 
        complementary-mRNA-base  (item (1 + (triplet-counter * 3)) code) 
        complementary-mRNA-base  (item (2 + (triplet-counter * 3)) code)
        )
      build-tRNA-for-this-triplet  this-triplet triplet-counter
      set triplet-counter triplet-counter + 1
    ]
  ]
end 

to build-tRNA-for-this-triplet [this-triplet triplet-counter]
  let this-tRNA nobody  
  hatch 1 [
    set breed tRNAs 
    set this-tRNA self
    set shape "tRNA-core"
    set size 1.2
    set heading 0
    hatch 1 [
      set breed amino-acids 
      set value  (which-protein-for-this-codon this-triplet)
      set shape (word "amino-" value)
      set heading 0
      set size 2
      fd 1
      create-backbone-from this-tRNA  [set hidden? true set tie-mode "free" tie] 
      attach-tag 20 .8 value nucleo-tag-color  
    ]
    hatch 1 [
      set breed tRNA-nucleotides
      set shape (word "trna-" (item 0 this-triplet)) 
      set heading -155
      fd 1.1
      set heading 0  
      create-backbone-from this-tRNA  [set hidden? true set tie-mode "fixed" tie]       
      hatch 1 [
        set breed tRNA-nucleotides
        set shape (word "trna-" (item 1 this-triplet)) 
        set heading 90
        fd .45
        set heading 0 
        create-backbone-from this-tRNA  [set hidden? true set tie-mode "fixed" tie] 
      ]
      hatch 1 [
        set breed tRNA-nucleotides
        set shape (word "trna-" (item 2 this-triplet)) 
        set heading 90
        fd .90
        set heading 0   
        create-backbone-from this-tRNA  [set hidden? true set tie-mode "fixed" tie]          
      ]
    ]
    fd 1
    set heading 90
    fd nucleotide-spacing + ( nucleotide-spacing * 3 * triplet-counter )
    set heading 0
  ]
end 


;; fine tuned placement of the location of a label for a nucleoside or nucleotide

to attach-tag [direction displacement label-value color-value]  
  hatch 1 [
    set heading direction
    fd displacement
    set breed tags
    set label label-value
    set size 0.1
    set label-color color-value
    create-tagline-with myself [set tie-mode "fixed" set hidden? true tie]
  ]
end 



;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;; visibility procedures ;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;

to visualize-all-genes
   ask (turtle-set promoters terminators)[ask link-neighbors [set hidden? not show-genes?] set hidden? not show-genes?]
end 

to hide-genes  [strand-type]
   ask (turtle-set promoters terminators)  with [strand = strand-type] [ask link-neighbors [set hidden? true] set hidden? true]
end 

to hide-mrna  [strand-type]
   ask (turtle-set mrnas mrna-nucleotides) with [strand = strand-type] [ask tagline-neighbors [set hidden? true] set hidden? true]   
end 

to hide-trna  [strand-type]
   ask (turtle-set trnas trna-nucleotides amino-acids) with [strand = strand-type] [ask tagline-neighbors [set hidden? true] set hidden? true]   
end 

to show-next-mrna  [strand-type]
  let these-genes genes with [strand = strand-type]
  if count these-genes = 0 [display-user-message-no-genes]
  if strand-type = "original" [   
    set original-display-mrna-counter original-display-mrna-counter + 1
    if (original-display-mrna-counter > count these-genes) [set original-display-mrna-counter 1]
    ask mrnas with [strand = strand-type and cap-type = "start"] [
      ifelse gene-number != original-display-mrna-counter 
        [ask out-backbone-neighbors [set hidden? true ask tagline-neighbors [set hidden? true] ] set hidden? true] 
        [ask out-backbone-neighbors [set hidden? false ask tagline-neighbors [set hidden? false] ] set hidden? false]
      set traveling? false set released? false set ycor original-dna-ycor
    ]    
  ]
  if strand-type = "duplicate" [  
    set duplicate-display-mrna-counter duplicate-display-mrna-counter + 1
    if (duplicate-display-mrna-counter > count these-genes) [set duplicate-display-mrna-counter 1]
    ask mrnas with [strand = strand-type and cap-type = "start"] [
      ifelse gene-number != duplicate-display-mrna-counter
        [ask out-backbone-neighbors [set hidden? true ask tagline-neighbors [set hidden? true] ] set hidden? true] 
        [ask out-backbone-neighbors [set hidden? false ask tagline-neighbors [set hidden? false]] set hidden? false]
      set traveling? false set released? false set ycor duplicate-dna-ycor
    ]    
  ]
end 

to show-next-trna  [strand-type]
  let this-gene-number gene-number-for-this-strand strand-type
  ask mrnas with [strand = strand-type and cap-type = "start" and released? and gene-number = this-gene-number ] [
    ask trnas with [strand = strand-type] [ 
      ifelse gene-number = this-gene-number 
        [ask out-backbone-neighbors [set hidden? false ask tagline-neighbors [set hidden? false] ] set hidden? false]
        [ask out-backbone-neighbors [set hidden? true ask tagline-neighbors [set hidden? true] ] set hidden? true] 
      ]
  ]
end 

to display-user-message-no-genes
  user-message "There are no genes in this strand of DNA. A specific sequence of 3 nucleotides is required for a gene"
end 

to release-next-protein  [strand-type]
  let make-protein? false
  let this-gene-number gene-number-for-this-strand strand-type
  ask mrnas with [strand = strand-type and cap-type = "start" and released?  and gene-number = this-gene-number ] [
    
    ask trnas with [strand = strand-type] [
      ifelse gene-number = this-gene-number
        [ask out-backbone-neighbors [
         set make-protein? true
         set hidden? true
           ifelse breed = amino-acids 
             [set hidden? false ask tagline-neighbors [set hidden? false] ] 
             [set hidden? true ask tagline-neighbors [set hidden? true] ] 
           ] 
         ]
         [ask out-backbone-neighbors [set hidden? true ask tagline-neighbors [set hidden? true] ] set hidden? true]
         set hidden? true
    ]
    if make-protein? [make-protein strand-type ]
  ]
end 

to make-protein [strand-type]
  let this-gene-number gene-number-for-this-strand strand-type
  let this-protein-value ""
  let these-amino-acids amino-acids with [breed = amino-acids and strand-type = strand and gene-number = this-gene-number]
  let ordered-amino-acids sort-on [who] these-amino-acids
  foreach ordered-amino-acids [set this-protein-value (word   this-protein-value "-" ([value] of ?))]
  if not any? proteins with [strand = strand-type and value = this-protein-value] [
      hatch 1 [set breed proteins set value this-protein-value set hidden? true setxy 0 0]
  ]
end 

to release-next-mRNA-from-nucleus [strand-type]
  ask mRNAs with [strand = strand-type][set traveling? true set released? false]    
end 

   

;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;; runtime procedures ;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;

to go
  visualize-all-genes
  ;; these ? variables keep track of button press events being cued by the user
  if event-1-triggered?  [ show-next-mrna "original"                  set event-1-triggered? false  set event-1-completed? true set event-2-completed? false set event-3-completed? false set event-4-completed? false]
  if event-2-triggered? and event-1-completed?  [ release-next-mRNA-from-nucleus "original"  set event-2-triggered? false set event-3-completed? false set event-4-completed? false]
  if event-3-triggered? and event-2-completed?  [ show-next-trna "original"                  set event-3-triggered? false  set event-3-completed? true set event-4-completed? false]
  if event-4-triggered? and event-3-completed?  [ release-next-protein "original"            set event-4-triggered? false  set event-4-completed? true]

  if event-6-triggered?                        [ show-next-mrna "duplicate"                  set event-6-triggered? false set event-6-completed? true set event-7-completed? false set event-8-completed? false set event-9-completed? false]
  if event-7-triggered? and event-6-completed? [ release-next-mRNA-from-nucleus "duplicate"  set event-7-triggered? false set event-8-completed? false set event-9-completed? false]
  if event-8-triggered? and event-7-completed? [ show-next-trna "duplicate"                  set event-8-triggered? false set event-8-completed? true  set event-9-completed? false]
  if event-9-triggered? and event-8-completed? [ release-next-protein "duplicate"            set event-9-triggered? false set event-9-completed? true ]
  move-mRNA-molecules-out-of-nucleus 
  tick
end 

to move-mRNA-molecules-out-of-nucleus 
  ask mRNAs with [traveling? and cap-type = "start"] [
    if strand = "original" [
      if ycor < original-ribosome-ycor [ set ycor ycor + .1 ] 
      if ycor >= original-ribosome-ycor [ set traveling? false set released? true set event-2-completed? true]
    ]
    if strand = "duplicate" [
      if ycor > duplicate-ribosome-ycor [ set ycor ycor - .1] 
      if ycor <= duplicate-ribosome-ycor [ set traveling? false set released? true set event-6-completed? true]
    ]
  ]
end 

to show-protein-production
  clear-output
  let original-proteins proteins with [strand = "original"]
  output-print "Proteins Produced"
  output-print (word "from original DNA  = " count original-proteins)
  output-print "::::::::::::::::::"
  ask original-proteins [
    output-print (word "Orig.Gene #" gene-number " > Protein:")
    output-print value
    output-print ""
  ]
  output-print "=================="
  let duplicate-proteins  proteins with [strand = "duplicate"]
  output-print "Proteins Produced"
  output-print (word "from copy of DNA = " count duplicate-proteins)
  output-print "::::::::::::::::::"  
  ask duplicate-proteins [
    output-print (word "Copy.Gene #" gene-number " > Protein:")
    output-print value
    output-print ""
  ]
end 

;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;; make duplicate dna procedures ;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;

to make-duplicate-dna-string 
  let position-counter 0
  set duplicate-strand-gene-counter 0
  let clean-duplicate-dna-string original-dna-string
  let mutating-copy-of-dna-string original-dna-string

    let target-loci random ((length mutating-copy-of-dna-string) - #-nucleotides-affected)
    let dna-at-target item target-loci mutating-copy-of-dna-string
    let dna-before-target substring mutating-copy-of-dna-string 0 target-loci
    let loci-counter 0 
    let dna-at-and-after-target substring mutating-copy-of-dna-string target-loci length mutating-copy-of-dna-string
    
    if mutation-type = "deletion"     
      [repeat #-nucleotides-affected  [set  mutating-copy-of-dna-string remove-item target-loci mutating-copy-of-dna-string]]
    if mutation-type  = "substitution" 
      [repeat #-nucleotides-affected  [set  mutating-copy-of-dna-string (replace-item (target-loci + loci-counter) mutating-copy-of-dna-string random-base-letter-DNA) set loci-counter loci-counter + 1] ]
    if mutation-type  = "insertion"     
      [repeat #-nucleotides-affected [set  dna-at-and-after-target (word random-base-letter-DNA  dna-at-and-after-target) ] set mutating-copy-of-dna-string (word dna-before-target dna-at-and-after-target)]

 set duplicate-dna-string mutating-copy-of-dna-string
end 

to replicate-dna
  let turtles-to-remove (turtle-set nucleotides mrnas trnas genes promoters terminators amino-acids mrna-nucleotides)
  ;; (re)build the everything for the duplicate dna
  ask turtles-to-remove with [strand = "duplicate" ][ask tagline-neighbors [die] die]            ;; wipe out old nucleotides
  make-duplicate-dna-string  
  build-genes-from-dna "duplicate" duplicate-dna-string
  make-a-nucleotide-chain-for-dna-string "duplicate" duplicate-dna-string
  place-dna "duplicate"
  build-mrna-for-each-gene "duplicate" 
  build-protein-from-mrna "duplicate"
  place-trnas "duplicate"  
  hide-mrna   "duplicate"
  hide-trna   "duplicate"
  hide-genes  "duplicate"
end 



;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;; initializing lists and strings ;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;

to initialize-codon-to-amino-acid-key
   set codon-to-amino-acid-key [
     ;;all triplets where the 2nd base is U
     ["UUU" "Phe"] ["UUC" "Phe"] ["UUA" "Leu"] ["UUG" "Leu"]
     ["CUU" "Leu"] ["CUC" "Leu"] ["CUA" "Leu"] ["CUG" "Leu"]
     ["AUU" "Ile"] ["AUC" "Ile"] ["AUA" "Ile"] ["AUG" "Met"] 
     ["GUU" "Val"] ["GUC" "Val"] ["GUA" "Val"] ["GUG" "Val"] 
     ;;all triplets where the 2nd base is C
     ["UCU" "Ser"] ["UCC" "Ser"] ["UCA" "Ser"] ["UCG" "Ser"]
     ["CCU" "Pro"] ["CCC" "Pro"] ["CCA" "Pro"] ["CCG" "Pro"]
     ["ACU" "Thr"] ["ACC" "Thr"] ["ACA" "Thr"] ["ACG" "Thr"] 
     ["GCU" "Ala"] ["GCC" "Ala"] ["GCA" "Ala"] ["GCG" "Ala"] 
     ;;all triplets where the 3rd base is A
     ["UAU" "Tyr"] ["UAC" "Tyr"] ["UAA" "Stop"] ["UAG" "Stop"]
     ["CAU" "His"] ["CAC" "His"] ["CAA" "Gln"] ["CAG" "Gln"]
     ["AAU" "Asn"] ["AAC" "Asn"] ["AAA" "Lys"] ["AAG" "Lys"] 
     ["GAU" "Asp"] ["GAC" "Asp"] ["GAA" "Glu"] ["GAG" "Glu"]    
     ;;all triplets where the 4th base is G
     ["UGU" "Cys"] ["UGC" "Cys"] ["UGA" "Stop"] ["UGG" "Trp"]
     ["CGU" "Arg"] ["CGC" "Arg"] ["CGA" "Arg"] ["CGG" "Arg"]
     ["AGU" "Ser"] ["AGC" "Ser"] ["AGA" "Arg"] ["AGG" "Arg"] 
     ["GGU" "Gly"] ["GGC" "Gly"] ["GGA" "Gly"] ["GGG" "Gly"]      
     ]
end 



;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;; reporters ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;

;;;;;; returns values such as "Gly" for "GGA" or "Tyr" for "UAC" using the codon-to-amino-acid-key

to-report which-protein-for-this-codon [this-codon]
 report item 1 (item 0 filter [first ? = this-codon] codon-to-amino-acid-key )
end 

;;; reports a random base for a nucleotide in DNA 

to-report random-base-letter-DNA
  let r random 4
  let letter-to-report "" 
  if r = 0 [set letter-to-report "A"]
  if r = 1 [set letter-to-report "G"]
  if r = 2 [set letter-to-report "T"]
  if r = 3 [set letter-to-report "C"]
  report letter-to-report
end 

;;; reports a complementary base for a base pairing given the nucleotide from DNA or mRNA

to-report complementary-mRNA-base [base]
  let base-to-report ""
  if base = "A" [set base-to-report "U"]
  if base = "T" [set base-to-report "A"]
  if base = "U" [set base-to-report "A"]
  if base = "G" [set base-to-report "C"]
  if base = "C" [set base-to-report "G"]
  report base-to-report 
end 


;; cycles through next color in base-color list to assign to the next gene

to-report next-gene-color
  ifelse gene-color-counter >= (length base-colors) - 1
   [set gene-color-counter 0]
   [set gene-color-counter gene-color-counter + 1 ]
  report (item gene-color-counter base-colors)
end 

to-report gene-number-for-this-strand [strand-type]
  let this-gene-number 0
  if strand-type = "original"  [set this-gene-number original-display-mrna-counter]
  if strand-type = "duplicate" [set this-gene-number duplicate-display-mrna-counter]
  report this-gene-number
end 


;; reports the mrna code that gets transcribed from the dna

to-report mrna-string-from-dna-string [dna-string]
  let new-string dna-string
  let next-item 0 
  repeat length dna-string [
    set new-string (replace-item next-item new-string (complementary-mRNA-base (item next-item new-string))  )
    set next-item next-item + 1  
  ]
  report new-string
end 

;; reports a string of dna where any A, G, C, T letter is replaced with a random one of these, and any length beyond
;; characters is deprecated

to-report dna-string-with-non-nucleotide-characters-replaced [dna-string]
  let new-string dna-string
  let next-item 0 
  repeat length dna-string [
    set new-string (replace-item next-item new-string (replace-non-nucleotide-character (item next-item new-string))  )
    set next-item next-item + 1  
  ]
  if length dna-string > 64 [set new-string substring new-string 0 64]
  report new-string
end 

;; replaces any A, G, C, T letter is replaced with a random one of these

to-report replace-non-nucleotide-character [nucleotide-character]
   let character-to-return nucleotide-character
   if nucleotide-character != "A" and nucleotide-character != "T" and nucleotide-character != "C" and nucleotide-character != "G"
     [set character-to-return random-base-letter-DNA]
   report character-to-return
end 

;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;; instructions for players ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;

to-report current-instruction-label
  report ifelse-value (current-instruction = 0)
    [ "press setup" ]
    [ (word current-instruction " of " length instructions) ]
end 

to next-instruction
  show-instruction current-instruction + 1
end 

to previous-instruction
  show-instruction current-instruction - 1
end 

to show-instruction [ i ]
  if i >= 1 and i <= length instructions [
    set current-instruction i
    clear-output
    foreach item (current-instruction - 1) instructions output-print
  ]
end 

to-report instructions
  report [
    [
     "You will be simulating the process"
     "of protein synthesis from DNA that"
     "occurs in every cell.  And you will"
     "explore the effects of mutations"
     "on the proteins that are produced."
    ]
    [
     "When you press SETUP, a single"
     "strand of an unwound DNA molecule"
     "appears. This represents the state" 
      "of DNA in the cell nucleus during"
     "transcription."
    ]
    [
     "To produce proteins, each gene in"
     "the original DNA strand must be"
     "transcribed  into an mRNA molecule."  
     "Do this by pressing GO/STOP and"
     "then the 1-TRANSCRIBE button."
    ]
    [
     "For each mRNA molecule that was"
     "transcribed, press the 2-RELEASE"
     "button.  This releases the mRNA"
     "from the nucleus  into the ribosome" 
     "of the cell."
    ]
    [
     "For each mRNA molecule in the"
     "ribosome, press the 3-TRANSLATE"
     "button.  This pairs up molecules"
     "of tRNA with each set of three"
     "nucleotides in the mRNA molecule."
    ]
    [
      "For each tRNA chain built, press"
      "the 4-RELEASE button.  This"
      "releases the amino acid chain"
      "from the rest of the tRNA chain,"
      "leaving behind the protein"
      "molecule that is produced."
    ]
    [
      "Each time the 1-TRANSCRIBE"
      "button is pressed, the next gene"
      "in the original strand of DNA "
      "will be transcribed.  Press the 1-,"
      "2-, 3-, 4- buttons and repeat to"
      "translate each subsequent gene."
    ]
    [
      "When you press the 5-REPLICATE"
      "THE ORIGINAL DNA button a copy"
      "of the original DNA will be "
      "generated for a new cell"
      "(as in mitosis or meiosis) and"
      "it will appear in the green."
    ]
    [
      "The replicated DNA will have a"
      "# of random mutations, set by"
      "#-NUCLEOTIDES-AFFECTED, each"
      "mutation of the type set by"
      "MUTATION-TYPE. Press button 5)"
      "again to explore possible outcomes."
    ]
    [
      "Now repeat the same transcription,"
      "release, translation, and release"
      "process for the DNA in this new"
      "cell by pressing 6-, 7-, 8-, 9-."
      "Repeat that sequence again to"
      "cycle through to the next gene."
    ]
    [
      "If you want to test the outcomes"
      "for your own DNA code, type any"
      "sequence of A, G, T, C in the"
      "USER-CREATED-CODE box and set"
      "the INITIAL-DNA-STRING to"
      "“from-user-code”.  Then press"
      "SETUP and start over again."
    ]
  ]
end 

to reset-completed-events
  
  if event-1-triggered? or  event-2-triggered? or event-3-triggered? or event-4-triggered? [
    set event-4-completed? false
    if event-1-triggered? or  event-2-triggered? or event-3-triggered? [
      set event-3-completed? false
      if event-1-triggered? or  event-2-triggered?  [
        set event-2-completed? false
        if event-1-triggered?  [ set event-1-completed? false ]
      ]
    ]
  ]
  if event-6-triggered? or event-7-triggered? or event-8-triggered? or event-9-triggered? [
    set event-9-completed? false
    if event-6-triggered? or  event-7-triggered? or event-8-triggered? [
      set event-8-completed? false
      if event-6-triggered? or  event-7-triggered?  [
        set event-7-completed? false
        if event-6-triggered?  [ set event-6-completed? false ]
      ]
    ]
    
  ]
end 


; Copyright 2012 Uri Wilensky.
; See Info tab for full copyright and license.

There are 3 versions of this model.

Uploaded by When Description Download
Uri Wilensky over 12 years ago Updated to NetLogo 5.0.4 Download this version
Uri Wilensky about 13 years ago Updated version tag Download this version
Uri Wilensky about 13 years ago Updated to version from NetLogo 5.0.3 distribution Download this version

Attached files

File Type Description Last updated
DNA Protein Synthesis.png preview Preview for 'DNA Protein Synthesis' almost 13 years ago, by Uri Wilensky Download

This model does not have any ancestors.

This model does not have any descendants.